mmpc-logo
twitter-logo @NationalMMPC
| Create Account | login
Strain
C57BL/6-Tg(Adipoq-Tnmd)

Summary Data Summary
Official Name C57BL/6-Tg(Adipoq-Tnmd)
Common Name p5.4-TNMD-Flag Mice
Description Full-length mouse Tnmd with a C-terminal Flag tag was
inserted 3' to 5.4-kb adiponectin promoter at the Cla I
site69. After verifying both ends by sequencing, the
transgenic cassette was linearized by Kpn1 and Xho1
digestion, purified and submitted for pro-nuclear injection.
The transgene was introduced into embryos from C57BL/6J mice
(000058; Jackson Laboratories). Embryos were then implanted
into pseudopregnant C57BL6/J females by the UMASS Transgenic
Animal Facility. Male transgenic animals were crossed with
C57BL6/J females. Genotyping was performed by PCR from
genomic DNA with the following primers: 5'-
GACCAGAATGAGCAATGGGTG , 3'- ATCGTCGTCATCCTTGTAGTCG -3'.
Development Status Phenotyping ongoing
Creation Method transgenic
TypeCount
Investigators 1
Genomics - Transgenes 1
Experiments 3


Investigators
NameInstitution
Michael CzechUniversity of Massachusetts Medical School


Genomic Information
EnhancerPromoterGeneCopies
Not SpecifiedAdipoqTnmdNot Specified


Menu

Home
Contact
About MMPC
Animal Husbandry
Tests Data
Search Data
Analysis
Clients
MMPC Centers

Newsletter

Interested in receiving MMPC News?
twitter-logo Mouse Phenotyping
@NationalMMPC



2017 National MMPC. All Rights Reserved.